\n<\/p>\n
Wild-type C57BL\/6 male mice (6\u20138\u2009weeks\u00a0of age) were purchased from BIKAI. Nlrx1\u2212\/\u2212 mice were purchased from Cyagen. NSG mice were purchased from Shanghai Model Organisms Center. All mice were housed in the specific-pathogen-free animal facility of Fudan University with the following environmental parameters: temperature maintained at 21\u201325\u2009\u00b0C, relative humidity at 45\u201365% and a 12\u2009h\u201312\u2009h light\u2013dark cycle.<\/p>\n
All mice were randomly separated into each experiment group. Mice were fasted from 10:00 for 24\u2009h with free access to water without food. PBS or HC (59847, Sigma-Aldrich; 100\u2009mg per kg) was intraperitoneally injected into mice at 10:00 for 4\u2009h. For acetate administration, mice were fasted for 24\u2009h and PBS or sodium acetate (S5636, Sigma-Aldrich; 1\u2009g per kg) was intraperitoneally injected 10\u2009h and 1\u2009h before mice were euthanized. For serum collection, mice were fasted overnight for 16\u2009h with free access to water. For food reintroduction, mice were fasted for 24\u2009h and then re-fed for another 24\u2009h. Mice were euthanized and the indicated tissues were collected for subsequent analysis.<\/p>\n
For the KPC model used in the MRTX1133 therapy experiment, 1\u2009\u00d7\u2009106 KPC\u00a0cells were subcutaneously injected into 6- to\u00a08-week-old NSG mice. The vernier calliper measurements begun when the tumours reached around 200\u2009mm3. Tumour volume measurements were recorded three times per week using the formula 0.5\u2009\u00d7\u2009length\u2009\u00d7\u2009width2. A blinded study design was used in the mouse tumour experiment to prevent bias during data collection and assessment, thus mice were randomized into control and treatment groups, and treated by intraperitoneal injection with vehicle (10% DMSO\u2009+\u200990% (20% SBE-\u03b2-CD in saline) or MRTX1133 in vehicle (30\u2009mg per kg, twice a day) when the tumour volume reached around 300\u2009mm3. Tumours were collected after 6 days of treatment. All of the animal experiment procedures, including the maximal tumour volume, were approved by ethics committee of Department of Laboratory Animals, Fudan University.<\/p>\n
Plasmids for the AAV2\/9 system, including pAAV RC2\/9 plasmids, pAAV helper plasmids and transgene plasmids with the CMV or U6 promoter were used for global expression or the knockdown of genes in vivo respectively as previously described44. The plasmids were mixed with PEI solution and transfected into HEK293T cells. Then, 60\u201372\u2009h after transfection, the cells and medium were collected by centrifugation (3,500\u2009rpm, 4\u2009\u00b0C, 5\u2009min). 5\u00d7 polyethylene glycol (40% PEG 8000, 2.5\u2009M NaCl) was added to the supernatant and incubated at 4\u2009\u00b0C overnight followed by centrifugation (3,000\u2009rpm, 4\u2009\u00b0C, 5\u2009min) to collect the virus pellet. Meanwhile, the cell pellet was resuspended with lysis buffer (150\u2009mM NaCl, 20\u2009mM Tris-Cl, pH\u20098.0) and lysed by three freeze\u2013thaw cycles between liquid N2 and a 37\u2009\u00b0C water bath followed by centrifugation (5,500\u2009rpm, 4\u2009\u00b0C, 10\u2009min) to obtain the supernatant. Then the supernatant was mixed with the virus pellet. The mixture was purified by Optiprep (D1556-250mL, Sigma-Aldrich) gradients (17%, 25%, 40% and 60%) centrifugation (40,000\u2009rpm, 16\u2009\u00b0C, 2\u2009h). The viral fraction was collected from the 40% gradient, then washed three times with PBS using 100\u2009kDa columns (3,500\u2009rpm, 4\u2009\u00b0C, 30\u2009min).<\/p>\n
AAVs were administered to C57BL\/6J mice through gastrocnemius injection (5\u2009\u00d7\u20091010 copies, 25\u2009\u03bcl per mouse, three sites) or tail injection (1\u2009\u00d7\u20091011 copies, 150\u2009\u03bcl per mouse). All experiments were performed 3\u20134 weeks after AAV injection. The efficiency of Nlrx1 knockdown or overexpression mediated by AAV delivery was validated by immunoblotting.<\/p>\n
WT NLRX1 (HA tag), the NACHT domain (amino acids 160\u2013483, HA tag), LRR domain (amino acids 669\u2013975, Flag tag), \u0394LRR (amino acids 1\u2013668, HA tag), 4A (four sites, Glu729, Lys754, Gln758 and Arg958, were mutated to Ala, HA tag) of NLRX1, NLRX1-GFP11 (the C terminus of NLRX1 without stop codon was fused to the linker GGSGGGS and the GFP11 tag RDHMVLHEYVNAAGIT), NLRX1-GFP11-IRES-RFP (the C terminus of NLRX1-GFP11 fused to IRES and RFP), HSP60-GFP11 (the C terminus of HSP60 without stop codon was fused to the linker and the GFP11 tag), GFP11-TOM20 (the GFP11 and the linker fused to the N terminus of TOM20) and HA-NLRP3 were constructed into pcDNA3.1 vector; WT NLRX1-HA, \u0394LIR-NLRX1 (amino acid deletion 461\u2013466, HA tag), NLRX1(\u0394N-ter) (amino acids 156\u2013975, HA tag), NLRX1(Cyto) (amino acids 87\u2013975, Flag tag), NLRX1(ER) (the N terminus of NLRX1(Cyto) fused to the amino acids 81\u2013250 of FAM134B, Flag tag) were generated as previously described6; cytoGFP(1\u201310), matrixGFP(1\u201310) (the N terminus of GFP1\u201310 was fused to the MTS of COX8, residues 1\u201336) and GFP-Parkin were generated into the pLVX-hygro vector, and GFP-LC3B was generated into pQCXIH. Constructs encoding mt-Keima and MTS-eGFP were generated into the pLVX or pLVX-Tet-On vector.<\/p>\n
Guide RNAs targeting human or mouse NLRX1 were designed online (http:\/\/www.e-crisp.org\/E-CRISP\/) and inserted into the pLentiCRISPR v2 vector.<\/p>\n
For NLRX1\u2013HA knock-in cell generation, the guide RNA (5\u2032-TCTGGAAGCTGAGACACTGG-3\u2032) was cloned into the pX458 plasmid. The homology arm of NLRX1-800-stop codon-+800 cloned into pcDNA 3.1 with a mutation at the PAM site from CGG to CCG and HA tag (TACCCCTACGACGTCCCCGACTACGCC) sequence was inserted before the stop codon.<\/p>\n
AcCoA sodium salt (AcCoA) (A2056), CoASH (C4780), malonyl-CoA (M4263) and sodium acetate (acetate) (S5636) were obtained from Sigma-Aldrich. Succinly-CoA (HY-137808) was obtained from MCE. Biotin was conjugated to the amino groups (-NH2) of AcCoA by EZ-Link sulfo-NHS-LC-biotin (A39257, Thermo Fisher Scientific) according to the manufacturer\u2019s instructions.<\/p>\n
Anti-TIM23 (mouse, 611223, BD Biosciences, 1:5,000), anti-MT-CO2 (rabbit, ab79393, Abcam, 1:3,000), anti-CYTB (rabbit, 55090-1-AP, Proteintech, 1:5,000), anti-HSP60 (goat, sc-13115, Santa Cruz Biotechnologies, 1:1,000), anti-LC3 (rabbit, 3868S, CST, 1:1,000), anti-HA (mouse, 901513, BioLegend, 1:1,000), anti-Flag (mouse, F3165, Sigma-Aldrich, 1:3,000), anti-NLRX1 (rabbit, 17215-1-AP, Proteintech, 1:1,000), anti-PINK1 (rabbit, BC100-494SS, Novus Biologicals, 1:1,000), anti-ACLY (rabbit, 15421-1-AP, Proteintech, 1:1,000), anti-ACSS2 (rabbit, 16087-1-AP, Proteintech, 1:1,000), anti-FASN (rabbit, 10624-2-AP, Proteintech, 1:3,000), anti-ACC1 (rabbit, 21923-1-AP, Proteintech, 1:2,000), anti-IDH1 (rabbit, 12332-1-AP, Proteintech, 1:3,000), anti-p62 (rabbit, 18420-1-AP, Proteintech, 1:3,000), anti-acetylated-lysine (rabbit, 9441, CST, 1:1,000), anti-phospho-AMPK\u03b1 (rabbit, 40H9, CST, 1:1,000), anti-AMPK\u03b1 (rabbit, 10929-2-AP, Proteintech, 1:3,000), anti-ULK1 (rabbit, 8054, CST, 1:1,000), anti-phosphorylated ULK1 (Ser757) (rabbit, 6888, CST, 1:1,000), anti-phosphorylated ULK1 (Ser555) (D1H4) (rabbit, 5869, CST, 1:1,000), anti-S6 kinase (S6K) (rabbit, 9202, CST, 1:1,000), anti-phospho-S6K (Thr389) (mouse, 9206, CST, 1:1,000), anti-cytochrome c (rabbit, 556432, BD Biosciences, 1:1,000), anti-Parkin (rabbit, Proteintech, 66674-1-Ig, 1:500), anti-CLIMP63 (mouse, ENZ-ABS-669-0100, ENZO, 1:500), anti-FIP200 (rabbit, 17250-1-AP, Proteintech, 1:3,000), anti-ATG7 (rabbit, 10088-2-AP, Proteintech, 1:3,000), anti-tubulin (rabbit, 11224-1-AP, Proteintech, 1:5,000), anti-actin (mouse, 66009-1-Ig, Proteintech, 1:5,000) were used in immunoblotting. Anti-LC3 (rabbit, PM036, MBL, 1:100), anti-HA (mouse, 901513, BioLegend, 1:1,000), anti-TOM20 (mouse, 612278, BD Biosciences, 1:1,000) and anti-HSP60 (goat, sc-13115, Santa Cruz Biotechnologies, 1:1,000) were used in immunofluorescence. The fluorescent secondary antibodies goat anti-mouse Alexa Fluor 594 (A11032, Invitrogen, 1:1,000), donkey anti-rabbit Alexa Fluor 594 (A21207, Invitrogen, 1:1,000), donkey anti-mouse Alexa Fluor 488 (A21202, Invitrogen, 1:1,000) and donkey anti-goat Alexa Fluor 647 (A21447, Invitrogen, 1:1,000) were used in immunofluorescence.<\/p>\n
HC (59847), BTC (51520) and CCCP (C2759) were from Sigma-Aldrich. SB (HY-16450), actinomycin D (HY17559), MRTX1133 (HY-134813), RMC-6236 (HY-148439), Torin-1 (HY-13003) and Mdivi-1 (HY-15886) were from MCE. Bafilomycin A1 (S1413) was from Selleck. Oligomycin (9996) was from CST.<\/p>\n
HEK293T, HeLa, A549, MCF7 and U-2 OS cells were purchased from ATCC and AsPC-1 cells were purchased from National Collection of Authenticated Cell Cultures (NCACC), Shanghai. Sf9 cells were purchased from Invitrogen. KPC (KrasG12D\/+Trp53R172H\/+) cells were obtained from Z.-G. Zhang. HEK293T, HeLa, A549, MCF7, U-2 OS, KPC cells and AsPC-1 cells were cultured in DMEM (Invitrogen) or RPMI-1640 (Invitrogen) supplemented with 10% FBS (BI) and 1% penicillin\u2013streptomycin (HyClone). Sf9 cells were cultured in SF900 II SFM (Gibco). The SM is the DMEM formula with 5\u2009mM glucose, 2\u2009mM glutamine, 1\u2009mM pyruvate and supplemented with 10% dialysed serum (BI) and 1% penicillin\u2013streptomycin (HyClone). All cell lines were grown at 37\u2009\u00b0C and 5% CO2 and were tested to be mycoplasma free using the mycoplasma detection kit (40612ES25, YEASEN). A notable exception was the Sf9 cell line, which was maintained under distinct conditions: incubation at 28\u2009\u00b0C with shaking on a horizontal shaker at a rotational speed of 100\u2009rpm.<\/p>\n
NLRX1-knockout cells were generated using the CRISPR\u2013Cas9 system. pLentiCRISPR v2 vectors carrying sgRNA were mixed in Opti-MEM and transfected into cells with polycation polyethylenimine (PEI) (Sigma-Aldrich) and selected by puromycin for 3\u2009days to get NLRX1-deficient cells. Single cells were seeded into 96-well plates and validated by sequencing and immunoblotting to get NLRX1-knockout cells. To generate NLRX1\u2013HA-tag knock-in cells (HeLa-NLRX1(HA-KI)), the plasmid pX458 together with donor DNA (amplification of plasmid pcDNA3.1 containing the homology arm of NLRX1) with a ratio of 1:1 in Opti-MEM were transfected with Lipo3000 (Invitrogen) into HeLa cells. After 48\u2009h transfection, GFP-positive cells were sorted and seeded into the 96-well plate (single clone per well) by flow cytometry. The knock-in cells were validated by sequencing and immunoblotting.<\/p>\n
To generate cells with the inducible expression of mt-Keima, HeLa cells were infected with viruses expressing pLVX-Tet3G-rtTA and selected with G418 (800\u2009\u03bcg\u2009ml\u22121) for 1\u2009week to get HeLa-rtTA cells. HeLa-rtTA cells were then infected with viruses expressing mt-Keima, followed by blasticidin (10\u2009\u03bcg\u2009ml\u22121) selection for an additional 1\u2009week to generate HeLa-Tet-On-mt-Keima cells. The expression of mt-Keima was induced by doxycycline (1\u2009\u03bcg\u2009ml\u22121) for 6\u2009h.<\/p>\n
To generate stable cell lines, cells were infected with indicated viruses together with 10\u2009\u03bcg\u2009ml\u22121 polybrene. After 48\u2009h, cells were selected with 2\u2009\u03bcg\u2009ml\u22121 puromycin, 50\u2009\u03bcg\u2009ml\u22121 hygromycin, 10\u2009\u03bcg\u2009ml\u22121 blasticidin or 800\u2009\u03bcg\u2009ml\u22121 G418 for 1\u20132 weeks. The overexpression or knockdown efficiency was verified by immunoblotting.<\/p>\n
For transient gene overexpression, cells were transfected with indicated plasmids using Lipo3000 (for HeLa cells) or PEI (for HEK293T cells). Gene expression was validated by immunoblotting or immunofluorescence 24\u201348\u2009h after transfection.<\/p>\n
Lentiviral or retroviral vectors carrying the indicated genes, together with packaging plasmids psPAX2 and pMD2.G or VSVG and GAG were transfected into HEK293T cells. After 48\u201372\u2009h, the supernatants were collected, filtered with a 0.45-\u03bcm filter and concentrated with PEG8000.<\/p>\n
siRNAs were transfected by Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer\u2019s instructions and, after 48\u2009h, the transfected cells were treated as indicated and collected for subsequent analysis.<\/p>\n
For mitochondria isolation, cells were washed with cold PBS twice and collected with 1\u2009ml cold mitochondrial lysis buffer as previously described45. The buffer containing 210\u2009mM mannitol, 70\u2009mM sucrose, 5\u2009mM Tris\u2013HCl (pH\u20097.5) and 1\u2009mM EDTA (pH\u20098.0), was adjusted to pH\u20097.5 with protease inhibitors. Then the cell suspension was transferred to the Dounce Tissue Grinder (P1110, T2690, Sigma-Aldrich) and lysed by 26 strokes. The homogenate was centrifuged at 1,300g for 10\u2009min at 4\u2009\u00b0C and the supernatant was collected in new tubes followed by centrifugation (10,000g, 4\u2009\u00b0C, 20\u2009min) to generate the supernatant as the cytosolic fraction and the cell pellet as the mitochondrial fraction.<\/p>\n
For immunoblotting, cells were lysed in 1\u00d7 SDS buffer, boiled at 95\u2009\u00b0C for 10\u2009min and analysed by SDS\u2013PAGE. For LC3 analysis, cells were lysed by buffer F (20\u2009mM Tris-HCl, pH\u20097.4, 150\u2009mM NaCl, 10% glycerol, 0.5% NP-40 and protease inhibitors) and centrifuged for 15\u2009min at 4\u2009\u00b0C. The supernatants were collected and boiled with 3\u00d7 SDS and analysed by SDS\u2013PAGE. For biotin\u2013AcCoA pull-down assays, cells were collected and mitochondria were purified as described above. Mitochondria pellets were lysed by buffer C (50\u2009mM HEPES, pH\u20097.5, 150\u2009mM NaCl, 1% NP-40, 2\u2009mM EDTA and protease inhibitors) and centrifuged for 15\u2009min at 4\u2009\u00b0C; the supernatants were then collected for the biotin\u2013AcCoA-binding assay. Streptavidin beads (3419, CST) were incubated with biotin or biotin-labelled AcCoA in PBS for 1\u2009h at room temperature, the beads were washed once with PBS and then incubated with cell lysates overnight at 4\u2009\u00b0C with rotation. On the second day, the beads were washed four times with buffer C, boiled with 1\u00d7 SDS and analysed by SDS\u2013PAGE. For GST\u2013LC3 pull-down assays, GST beads (AGM90049, AOGMA) were incubated with recombinant GST\u2013LC3 for 4\u2009h at 4\u2009\u00b0C, then washed with buffer C and incubated with cell lysates at 4\u2009\u00b0C for 4\u2009h with rotation. The beads were washed four times with buffer C, boiled with 1\u00d7 SDS and analysed by SDS\u2013PAGE. For LRR-domain binding with the NACHT domain, cells were lysed with lysis buffer (0.5% Triton X-100, 20\u2009mM HEPES pH\u20097.6, 150\u2009mM NaCl, 12.5\u2009mM \u03b2-glycerophosphate, 1.5\u2009mM MgCl2, 2\u2009mM EGTA with protease inhibitors). AcCoA was co-added with Flag beads (A2220, Sigma-Aldrich) into the lysates overnight at 4\u2009\u00b0C with rotation. The beads were washed and protein samples were processed as described above.<\/p>\n
For AMPK activation and mTOR inhibition analysis, HeLa, A549 and MCF7 cells were treated with SM (DMEM containing 5\u2009mM glucose, 2\u2009mM glutamine and 1\u2009mM pyruvate sodium with 10% dialysed serum and 1% penicillin\u2013streptomycin) for 16\u2009h. Oligomycin (5\u2009\u03bcM, 5\u2009min) or Torin-1 (100\u2009nM, 16\u2009h) was used as a positive control. Cells were washed with precooled PBS twice and lysed with precooled lysis buffer containing 20\u2009mM Tris-HCl, pH\u20097.4, 150\u2009mM NaCl, 1\u2009mM EDTA, 1\u2009mM EGTA, 1% Triton X-100, 2.5\u2009mM pyrophosphate, 50\u2009mM NaF, 5\u2009mM \u03b2-glycerol phosphate, 50\u2009nM calyculin A, 1\u2009mM Na3VO4 and protease inhibitors. The lysates were centrifuged at 17,000g for 10\u2009min at 4\u2009\u00b0C, and the supernatant was boiled with 3\u00d7 SDS and analysed by SDS\u2013PAGE46.<\/p>\n
For all immunoblotting analyses, proteins were separated by 10\u201312% SDS\u2013PAGE, transferred to PVDF membranes (Amersham), blocked by 5% non-fat milk in 0.1% Tween-20\/PBS buffer for 1\u2009h at room temperature, and immunoblotted by antibodies according to molecular mass. All uncropped raw immunoblotting data are provided in Supplementary Fig. 1.<\/p>\n
Human NLRX1 without the N-terminal MTS (amino acids 87\u2013975) was cloned into the pFastBac His vector with an additional N-terminal MBP tag. The vector was then transfected into DH10Bac to get recombinant bacmids, which were further transfected into SF9 insect cells to get amplified baculovirus. SF9 cells were infected with amplified baculovirus for 3\u2009days and cells were collected and lysed in HEPES buffer (20\u2009mM HEPES pH\u20097.5, 150\u2009mM NaCl) with protease inhibitors and 0.5\u2009mM Tris (2-carboxyethyl) phosphine (TCEP) with sonication. After centrifuging with 10,000\u2009rpm for 1\u2009h, supernatants containing recombinant NLRX1 were purified with Ni-NTA (QIAGEN) and gel-filtration chromatography on the Superdex 200 column (GE Healthcare). The purified recombinant MBP\u2013NLRX1\u2013His was confirmed by immunoblotting using NLRX1 antibody and used for biotin\u2013AcCoA pull-down assay.<\/p>\n
NLRX1 LRR domain (629\u2013975) or LRR(4A) were cloned into the pMAL-c5X vector with an N-terminal expressed MBP tag. Constructs were transfected into Escherichia coli BL21 (DE3) cells, which were incubated in LB medium (50\u2009\u03bcg\u2009ml\u22121 ampicillin) for 6\u2009h at 37\u2009\u00b0C with shaking. Protein expression was induced with 0.2\u2009mM isopropyl-\u03b2-D<\/span>-thiogalactopyranoside overnight at 18\u2009\u00b0C. Cells were collected and resuspended in HEPES buffer with protease inhibitors and 0.5\u2009mM TCEP. The proteins were further purified by gel-filtration chromatography on the Superdex 200 column (GE Healthcare Life Sciences) equilibrated with the HEPES buffer with 0.5\u2009mM TCEP. Dextrin beads (SA077025, Smart-Lifesciences) were used to purify recombinant proteins, washed with HEPES buffer and eluted with 5\u2009mM maltose.<\/p>\n Recombinant MBP\u2013NLRX1-LRR proteins (50\u2009\u03bcg) and equal amounts of MBP or MBP\u2013LRR(4A) proteins were incubated with dextrin beads for 2.5\u2009h at 4\u2009\u00b0C with rotation. Beads were washed twice with lysis buffer 2.0 (HEPES buffer with 2\u2009mM MgCl2, 0.5\u2009mM TCEP and 0.05% Tween-20). The beads were incubated with 2\u2009\u03bcM [3H]AcCoA (NET290250UC, Perkin Elmer) and the indicated concentrations of cold AcCoA for 1\u2009h at room temperature. The tubes were flicked every 10\u2009min. The beads were then washed four times with lysis buffer 2.0 and quantified using the TriCarb scintillation counter (PerkinElmer). The binding affinity Kd was calculated as previously described47.<\/p>\n Protein oligomerization analysis was conducted as previously described6,48. Cells were washed twice with PBS and centrifuged at 3,000\u2009rpm for 5\u2009min at 4\u2009\u00b0C. After resuspending in PBS, cell pellets were pipetted 24 times with a 22-gauge needle and centrifuged at 13,000\u2009rpm for 1\u2009h at 4\u2009\u00b0C followed by gentle sonication in PBS. The samples were divided into two parts\u2014one part was cross-linked with 1\u2009mM glutaraldehyde for 10\u2009min at 16\u2009\u00b0C and the other was not cross-linked as inputs. The samples were boiled at 95\u2009\u00b0C for 10\u2009min and analysed by immunoblotting after SDS\u2013agarose or SDS\u2013PAGE electrophoresis.<\/p>\n The NLRX1 structure was from the Protein Data Bank31 (PDB: 3UN9). The simulation of AcCoA or CoASH docking to LRR of NLRX1 was performed by Schr\u00f6dinger Computational Suite, Maestro v.11.5.011, MMshare v.4.1.011, release 2018-1, platform Windows-x64. All structure figures were prepared in Pymol (http:\/\/www.pymol.org).<\/p>\n Cells were treated as indicated and washed with PBS, collected in DMEM or RPMI1640 and centrifuged at 800g for 5\u2009min. Cells were stained with 100\u2009nM TMRM (T668, Invitrogen), 5\u2009\u03bcM MitoSOX (M36008, Invitrogen) or 10\u2009\u03bcM CM-H2DCFDA (HY-D0940, MCE) in DMEM or RPMI1640 for 30\u2009min at 37\u2009\u00b0C and 5% CO2. After the incubation, cells were washed twice with PBS and resuspended in DMEM or RPMI1640 followed by flow cytometry.<\/p>\n The split GFP system used for monitoring mitochondrial outer membrane or matrix protein localization has been previously described27,49,50. In brief, HeLa cells stably expressing cytoGFP(1\u201310) or matrixGFP(1\u201310) were transfected with construct encoding NLRX1(G11)-IRES-RFP. After 36\u201348\u2009h, cells were treated as indicated and flow cytometry was performed by Beckman coulter CytoFLEX S instrument. NLRX1 localization on the mitochondrial outer membrane or matrix was calculated on the basis of\u00a0the GFP+RFP+\/RFP+ ratio. For flow cytometry, 1\u00a0\u00d7\u00a0104\u00a0to\u00a02\u00a0\u00d7\u00a0104 cells were collected using the Beckman Courtier instrument, and the data were analysed by FlowJo v.10.8.1 software or CytExpert 2.5.<\/p>\n For intracellular ATP production measurement, the ATP Assay Kit (S0026, Beyotime) was used according to the manufacturer\u2019s instructions. In brief, cells were washed twice with PBS and lysed with lysis solution for 20\u2009min on ice followed by centrifugation (12,000g, 5\u2009min, 4\u2009\u00b0C). ATP assay working solution and the supernatants were co-added into a black 96-well plate. The luminescence was measured using a microplate reader (BioTek).<\/p>\n For the cell death assay, LDH was detected using the CytoTox 96 Non-Radioactive Cytotoxicity Assay kit (G1782, Promega) according to the manufacturer\u2019s instructions. In brief, cells were treated as indicated and the supernatants were transferred to a fresh 96-well plate. An equal volume of LDH detection working solution was added to each well plate and incubated at 37\u2009\u00b0C for 30\u2009min. The LDH positive control in the kit was used as the positive control. Finally, the absorbance signal was measured at 490\u2009nm using a microplate reader (BioTek).<\/p>\n For the measurement of NADP(H), the NADP+\/NADPH Assay Kit (Beyotime, S0180) was used according to the manufacturer\u2019s instructions. In brief, cells were washed twice with PBS, resuspended with extraction buffer and then centrifuged (12,000g, 5\u2009min, 4\u2009\u00b0C). The supernatant was divided into two equal parts. One part was used for total NADPH measurement. The other part was incubated for 30\u2009min at 60\u2009\u00b0C to decompose NADP+. The G6PDH assay working solution was then added to the supernatants in the 96-well plate and the mixture was incubated for 10\u2009min. Finally, the absorbance signal was measured at 450\u2009nm with a microplate reader (BioTek).<\/p>\n For 2D cell proliferation assay, cells were seeded into the black 96-well plate and treated with serial dilutions of MRTX1133 or RMC-6236, Mdivi-1 (20\u2009\u03bcM) or DMSO. Then, 50\u2009\u03bcl of CellTiter-Glo reagent was added to 50\u2009\u03bcl of medium-containing cells and the contents were mixed for 2\u2009min. The plate was next incubated at room temperature for 10\u2009min. The luminescence was measured using a microplate reader (BioTek). Luminescence signal was normalized to DMSO treated cells (percentage DMSO\u2009=\u2009(lumtreated\/mean(lumDMSO))\u2009\u00d7\u2009100). A log[inhibitor] versus response-variable slope (four parameters) model was used to calculate the IC50.<\/p>\n For intracellular metabolite measurements in Extended Data Fig. 1n, cells were cultured in 10\u2009cm dishes and treated with SM for 16\u2009h. When cell confluency was about 80\u2013100%, the medium was removed, cells were washed with cold PBS twice, collected in extraction buffer (acetonitrile:isopropanol:water, 3:3:2, v\/v\/v). The resuspended cells were placed in liquid N2 for 5\u2009min and thawed on ice for 5\u2009min and the freeze\u2013thaw cycle was repeated four times and the samples were then centrifuged (12,000\u2009rpm, 4\u2009\u00b0C, 10\u2009min) to collect the supernatants. For serum valine, leucine and isoleucine measurements in Extended Data Fig. 1c, blood was collected from the eyes and clotted at room temperature for 1\u2009h and then centrifuged (3,000\u2009rpm, 10\u2009min). Next, 20\u2009\u03bcl serum was diluted with 80\u2009\u03bcl precooled methanol and vortexed, then centrifuged at 12,000g for 15\u2009min to remove proteins. The cell or serum supernatants were then evaporated by freeze-vacuum and analysed by gas chromatography coupled with MS (GC\u2013MS). The pellets were resuspended in 75\u2009\u03bcl acetonitrile at 60\u2009\u00b0C for 15\u2009min, then oximated by MTBSTFA (N-tert-butyldimethylsilyl-N-methyltrifluoroacetamide) in 50\u2009\u03bcl pyridine and further incubated in 60\u2009\u00b0C for 1\u2009h. The samples were centrifuged and the supernatants were transferred to glass vials. Then, 1\u2009\u00b5l of each sample was injected and analysed on the Agilent 7890B-5977B GC\u2013MS system with DB-5MS (0.25\u2009mm internal diameter, 0.25\u2009\u03bcm film, with 30\u2009m empty column, Agilent J&W). Metabolite m\/z ratios were compared with those of\u00a0previous studies51. Each metabolite was quantified by the retention time and peak area by MassHunter Workstation (Agilent). The final intracellular metabolites and amino acid level was normalized to actin level of immunoblotting or volume of serum.<\/p>\n Cytosolic and mitochondrial AcCoA levels were determined as previously described45. In brief, approximately 1\u2009\u00d7\u2009107 to\u00a02\u2009\u00d7\u2009107 cells were lysed with 1\u2009ml cold mitochondrial lysis buffer and the cytosolic and mitochondria fractions were then isolated as described above. The cytosolic fraction was quenched by 50% (w\/v) trichloroacetic acid in water (the final concentration of trichloroacetic acid is 10%) and the mitochondria fraction was resuspended in 1\u2009ml 10% (w\/v) trichloroacetic acid. The mitochondria fraction was placed into liquid N2 for 5\u2009min and thawed on ice for 5\u2009min and the freeze\u2013thaw cycle was repeated four times followed by centrifugation (17,000g, 4\u2009\u00b0C, 10\u2009min). The mitochondria supernatants and cytosolic fractions were then purified using Oasis HLB 1cc (30\u2009mg) SPE columns (Waters). Columns were washed with methanol, equilibrated with water, loaded with the cytosolic and mitochondrial fractions, washed with water and eluted with elution buffer (25\u2009mM ammonium acetate in methanol). The elutions were evaporated by freeze-vacuum, resuspended in 20\u2009\u03bcl 20% acetonitrile in water and analysed by LC\u2013MS. For in vivo AcCoA measurement, tissues were obtained from C57BL\/6J mice, and 50\u2013100\u2009mg tissue was collected in 1\u2009ml precooled 10% trichloroacetic acid. The samples were then homogenized and lysed on a rotating shaker (30\u2009min, 4\u2009\u00b0C) followed by centrifugation (12,000g, 10\u2009min, 4\u2009\u00b0C). The supernatant was purified, dried and resuspended as described above, and analysed using LC\u2013MS. Then, 5\u2009\u00b5l of each sample was injected and analysed using SHIMADZU LC-30AB LC system coupled to the QTRAP7500 Mass Spectrometer (SCIEX). Hydrophilic interaction chromatography (HILIC) with the BEH column (1.7\u2009\u00b5m, 2.1\u2009mm\u2009\u00d7\u2009100\u2009mm; Waters) was used. Mobile phase A was as follows: ammonia with 10\u2009mM ammonium formate and 0.2% ammonia. Mobile phase B was acetonitrile. The flow rate was 0.2\u2009ml\u2009min\u22121 and the column temperature was set at 40\u2009\u00b0C. Linear gradient: 0\u2009min, 80% B; 3\u2009min, 50% B; 10\u2009min, 50% B; 10.1\u2009min, 80% B; 15\u2009min, 80% B. Multiple reaction monitoring (MRM) technology using MS\/MS was used for specific detection of AcCoA. The LC\u2013MS system was operated in negative ionization mode. The source parameters included curtain gas (CUR) at 40\u2009psi; collision active dissociation (CAD) gas at 6; ion source gas 1 (GS1) at 40\u2009psi, GS2 at 70\u2009psi; ion spray voltage (IS) at 4,500\u2009V; ion source temperature (TEM) at 450\u2009\u00b0C. The specific transition was recorded as follows: AcCoA 808.0945\u2009>\u2009407.9000. The final AcCoA level was normalized to the actin immunoblot level, or the tissue weight or cell number, as described in the figure legends.<\/p>\n For serum amino acid measurement (proline, glutamate acid, serine, asparagine, glutamine, arginine, glycine, alanine, aspartic acid, tyrosine, histidine, lysine, methionine, phenylalanine, threonine and tryptophan, while cysteine was too low to be detected), blood was collected from eyes and clotted at room temperature for 1\u2009h followed by centrifugation (3,000\u2009rpm,10\u2009min). Then, 20\u2009\u03bcl serum was diluted with 80\u2009\u03bcl precooled methanol and vortexed, then centrifuged at 12,000g for 15\u2009min to remove proteins. The supernatants were evaporated by freeze-vacuum, resuspended in 100\u2009\u03bcl 80% methanol in water and analysed by LC\u2013MS. Then, 1\u2009\u00b5l of each sample was injected and analysed using UPLC-H Class LC system (Waters) coupled to the 6500 QTRAP Mass Spectrograph (SCIES). The ultimate AQ-C18 column (5\u2009\u00b5m, 2.1\u2009mm\u2009\u00d7\u2009250\u2009mm; Welch) was used at room temperature. Mobile phase A was as follows: water (0.1% formic acid, v\/v); and mobile phase B was acetonitrile (0.1% formic acid, v\/v). Linear gradient: 0\u20131\u2009min, 0% B; 1\u201314\u2009min, 0\u201390% B; 14\u201316\u2009min, 90% B; 16\u201316.1\u2009min, 90\u20130% B; 16.1\u201320\u2009min, 0% B. The flow rate was 0.2\u2009ml\u2009min\u22121. MRM technology using MS\/MS was used for specific detection of various amino acids. The LC\u2013MS system was operated in positive ionization mode. The source parameters included CUR at 40\u2009psi; CAD at medium; GS1 at 40\u2009psi, GS2 at 40\u2009psi; IS at 5,500\u2009V; and TEM at 500\u2009\u00b0C. All LC\u2013MS analysis was performed by the Metabolic Platform at the Fudan University. Data were analysed using Skyline (22.2.0.527) software to calculate the peak area values.<\/p>\n The mitochondrial oxygen consumption rate (OCR) in HeLa cells was measured with the Seahorse XFe96 equipment (Agilent) using the Cell Mitochondrial Stress Test kit (103015-100, Agilent) according to the manufacturer\u2019s instructions. In brief, 0.8\u2009\u00d7\u2009104 cells were seeded onto an XFe96 cell culture microplate (Agilent) per well and treated with CCCP (10\u2009\u03bcM), SB (100\u2009\u03bcM), BTC (5\u2009mM), HC (20\u2009mM) and SM for 16\u2009h. Before analysis, cells were washed twice and equilibrated with XF DMEM in a 37\u2009\u00b0C incubator without CO2 for 1\u2009h. Oligomycin (final concentration: 1.5\u2009\u03bcM), FCCP (final concentration: 2\u2009\u03bcM), and rotenone\/antimycin A (final concentration: 0.5\u2009\u03bcM) were used in OCR analysis. Data were analysed by Seahorse Wave Desktop Software (Agilent).<\/p>\n To generate lentivirus for screening, we used the genome-wide GeCKO v2.0 Human library52 in the lentiCRISPR v2 vector (Addgene, 1000000048), which contains six sgRNAs per gene (123,411 sgRNAs targeting 19,050 genes). A total of 1\u2009\u00d7\u2009108 HEK293T cells was seeded into six T225 flasks. Each flask was transfected with 20\u2009\u03bcg of plasmid library, 10\u2009\u03bcg of psPAX2 and 5\u2009\u03bcg of pMD2.G using PEI. After 48\u2009h of transfection, the supernatant was collected, centrifuged at 3,000\u2009rpm for 5\u2009min, filtered through a 0.45-\u03bcm filter and stored at \u221280\u2009\u00b0C. Virus titres were determined using puromycin selection. The lentiviral library was used to infect HeLa cells stably transfected with doxycycline-inducible mt-Keima reporter at a multiplicity of infection of approximately 0.3 with 8\u2009\u03bcg\u2009ml\u22121 polybrene. Then, 48\u2009h after infection, 1\u2009\u03bcg\u2009ml\u22121 puromycin was added to the cells and selected for 5\u2009days, followed by an additional 2 days of expansion in puromycin-free medium. During selection, cells were maintained at >500 cells per sgRNA.<\/p>\n To induce mitophagy, cells were first treated with 1\u2009\u03bcg\u2009ml\u22121 doxycycline overnight to induce mt-Keima expression, followed by 20\u2009mM HC treatment for 16\u2009h. Treated cells were trypsinized, filtered through a 40-\u03bcm cell strainer and resuspended in PBS containing 2% FBS. Cell sorting was performed using a BD FACSAria II instrument with two channels: 405\u2009nm excitation for mt-Keima at pH\u20097 and 562\u2009nm excitation for mt-Keima at pH\u20094, with a 610\u2009nm emission bandwidth53. The top 25\u201330% and bottom 25\u201330% cells were sorted to represent mitophagy-enhanced and -inhibited cell subsets, respectively. A total of 107 cells was sorted for each group in two biological replicates for subsequent sequencing.<\/p>\n Genomic DNA was extracted from both the mitophagy-enhanced and -inhibited groups. Sequencing libraries were prepared by two rounds of PCR to amplify target DNA fragments, followed by the ligation of index and adapter sequences. The prepared libraries were then subjected to paired-end sequencing (2\u2009\u00d7\u2009150\u2009bp) on the Illumina NovaSeq 6000 platform. After sequencing, 20\u2009bp gRNA sequences were extracted and aligned to the GeCKO v2.0 library reference sequence. The alignment results for all library sequences were counted to obtain the number of matched reads. Sequencing depth and coverage were calculated to assess data reliability and accuracy. Two rounds of screening data were analysed using MAGeCK software54 with the default settings, and the results were ranked by negative log2-transformed fold change and P value. Mitochondrial genes were defined using the mitoCarta3.0 database22. Volcano plots for genome-wide and mitochondria-targeted analyses of the CRISPR screening were generated using the R package ggplot2. GO biological processes enriched in the top 100 mitochondrial genes from the screen were analysed using the Metascape database55.<\/p>\n To quantify the mtDNA\/nDNA ratio, genomic DNA was isolated from cells or tissues using the TIANamp Genomic DNA Kit (DP304-02, TIANGEN) according to the the manufacturer\u2019s instructions, and qPCR was conducted to amplify the mitochondria genome (MT-CYTB, MT-CO1, MT-ATP6 in human; mt-Cytb, mt-Co1, mt-Atp6 in mouse) or nuclear genome (RPL13A in human; Rpl13a in mouse) separately as previously described6. Total RNAs were extracted using the RNA Easy Fast Tissue\/Cell Kit (TIANGEN, DP451) and reverse transcribed using the PrimeScript RT Reagent kit (TaKaRa, RR047A) according to the manufacturer\u2019s instructions. The qPCR was performed on the ABI QuantStudio 7 Flex system using the TB Green Premix ExTaq kit (TaKaRa, RR820A). The relative fold changes were calculated using \\({2}^{-\\Delta \\Delta {C}_{{\\rm{t}}}}\\)<\/span> method. qPCR primer sequences are provided in Supplement Table 3.<\/p>\n For colocalization analysis of exogenous NLRX1 with exogenous LC3, HeLa cells stably expressing NLRX1 with a C-terminal HA tag (HeLa-NLRX1-WT) were cultured on glass coverslips and transfected with the vector expressing GFP\u2013LC3. For colocalization analysis of endogenous NLRX1 with endogenous LC3, HeLa cells with HA tag knock-in (HeLa-NLRX1(HA-KI)) were used. For colocalization analysis of GFP\u2013Parkin with mitochondria, HeLa cells stably expressing GFP\u2013Parkin were generated (HeLa-GFP\u2013Parkin). Cells were treated as indicated in the figure legends and washed with PBS twice, fixed with 4% PFA for 10\u2009min, permeabilized with 0.1% Triton X-100 in PBS for 10\u2009min, blocked with 5% BSA in PBS for 1\u2009h at room temperature and incubated with primary antibodies (diluted in 5% BSA) at 4\u2009\u00b0C overnight. The next day, cells were washed three times with PBS and incubated with fluorescent secondary antibodies for 2\u2009h at room temperature and then washed three times with PBS. After incubation with DAPI for 5\u2009min and mounted with antifade reagent, samples were observed with the \u00d760 oil objective of confocal microscopy (Leika SP5 and Olympys FV3000).<\/p>\n For analysis of mitochondrial protein import, HeLa-rtTA cells were transfected with vectors expressing Tet-On-MTS-EGFP. After 6\u2009h of transfection, 0.25\u2009\u03bcg\u2009ml\u22121 doxycycline was added to induce MTS-EGFP expression. Then cells were stained with 50\u2009nM Mitotracker Deep Red FM (M22426, Thermo Fisher Scientific) for 20\u2009min and washed with PBS twice, and fresh medium was added for living cell imaging using Olympys confocal microscope (FV3000) with a \u00d760 oil objective in two channels: 488\u2009nm excitation and 520\u2009nm emission for eGFP and 640\u2009nm excitation and 685\u2009nm emission for Mitotracker Deep Red FM. Three replicates with a total of 100 cells per condition were analysed29,56.<\/p>\n The split GFP system used for monitoring mitochondrial outer membrane or matrix protein localization was described above. In brief, HeLa cells stably expressing cytoGFP(1\u201310) or matrixGFP(1\u201310) were transfected with constructs encoding NLRX1-GFP11, HSP60-GFP11 or GFP11-TOM20 vectors. After 24\u2009h, living cells were observed using Olympus confocal microscope (FV3000) with a \u00d760 oil objective in the channel with 488\u2009nm excitation and 520\u2009nm emission for GFP. Images were processed by deconvolution using OLYMPUS CellSens Dimension Desktop (v.4.1.1) to improve resolution, remove background fluorescence and recover the real distribution.<\/p>\n For measuring in vivo mitophagy, 6\u20138-week-old mice were given\u00a0intramuscular\u00a0injection of AAV-mt-Keima (3\u2009\u00d7\u20091011 copies, 25\u2009\u03bcl per mouse, three sites) or intravenously (1\u2009\u00d7\u20091011 copies, 150\u2009\u03bcl per mouse). After 4\u20136 weeks, mice were fasted for 24\u2009h or given\u00a0intraperitoneal injection of HC for 4\u2009h, and gastrocnemius or liver tissues were collected. The samples were cut into sections with a thickness of 6\u2009\u03bcm and observed using Olympus confocal microscope (FV3000) with a \u00d760 oil objective in two channels: 445\u2009nm excitation for mt-Keima pH\u20097 and 561\u2009nm excitation for mt-Keima pH4 with a 570\u2013695\u2009nm emission bandwidth. For mitophagy index quantification, total mitochondrial area and mitolysosome area were calculated by green fluorescence area and red-only puncta area gated by a fixed threshold individually using Image J software. Mitophagy level was quantified by the ratio of mitolysosome area\/mitochondrial area.<\/p>\n For measuring in vitro mitophagy, cells were treated as indicated, and the flow cytometry was performed by Beckman coulter CytoFLEX S instrument in two channels (BV605 and PE-Texas Red channels) through two lasers (405\u2009nm and 562\u2009nm) and emission at 610\u2009nm. The gating strategy was provided in Supplementary Fig. 2. Data were analysed using CytExpert 2.5. The ratio of the mitophagic percentage was calculated and the quantification was pooled from three independent biological replicates.<\/p>\n HeLa cells were treated as indicated, washed with cold PBS and lysed with digitonin lysis buffer (150\u2009mM NaCl, 50\u2009mM HEPES pH\u20097.4, 25\u2009\u03bcg\u2009ml\u22121 digitonin with protease inhibitors) for 10\u2009min on ice. The lysates were then centrifuged at 2,000g for 10\u2009min at 4\u2009\u00b0C. The supernatants were centrifuged at 20,000g at 4\u2009\u00b0C twice, and the final supernatant was the cytosolic fraction for the detection of cytosolic cytochrome c57,58.<\/p>\n Cytosolic and mitochondrial fraction isolation was determined as previously described20. In brief, for mitochondria isolation from gastrocnemius tissue, mice were killed and muscles were removed, washed with cold PBS supplemented with 10\u2009mM EDTA and minced. The muscles were incubated with PBS supplemented with 10\u2009mM EDTA and 0.05% trypsin for 30\u2009min followed by centrifugation (200g, 10\u2009min, 4\u2009\u00b0C). The pellet was resuspended with IBm1 (67\u2009mM sucrose, 50\u2009mM Tris\/HCl, 50\u2009mM KCl, 10\u2009mM EDTA and 0.2% BSA, pH adjusted to 7.4) and transferred to the Dounce Tissue Grinder and lysed by 15 strokes followed by centrifugation (700g, 10\u2009min, 4\u2009\u00b0C). The supernatant was then centrifuged at 8,000g for 10\u2009min at 4\u2009\u00b0C. The supernatant is the cytosolic fraction. Then pellet was resuspended with IBm2 (0.25\u2009M sucrose, 3\u2009mM EGTA\/Tris and 10\u2009mM Tris\/HCl, pH adjusted to 7.4) followed by centrifugation (8,000g, 10\u2009min, 4\u2009\u00b0C) to obtain the mitochondrial pellet.<\/p>\n For mitochondria isolation from liver, mice were killed and livers were collected, washed with cold IBc (10\u2009mM Tris\u2013MOPS, 1\u2009mM EGTA\/Tris, 0.2\u2009M sucrose, pH adjusted to 7.4) and minced. Then the liver suspension was transferred to the Dounce Tissue Grinder and lysed by ten strokes, followed by centrifugation (600g, 10\u2009min, 4\u2009\u00b0C). The supernatant was then centrifuged at 7,000g for 10\u2009min at 4\u2009\u00b0C. The supernatant was the cytosolic fraction. The pellet was then resuspended with IBc followed by centrifugation (7,000g, 10\u2009min, 4\u2009\u00b0C) to obtain the mitochondrial pellet. For LC\u2013MS, both the cytosolic and mitochondrial fractions were performed as described above. For immunoblotting analysis, both the cytosolic and mitochondrial fractions were boiled with 3\u00d7 SDS and analysed by SDS\u2013PAGE.<\/p>\n HeLa cells were treated with indicated conditions, transformed into suspension cells using a cell shovel and centrifuged at 2,000\u2009rpm for 10\u2009min. The pellets were fixed in 2.5% glutaraldehyde for 1\u2009h at room temperature and then overnight at 4\u2009\u00b0C. The next day, after washing three times with 0.1\u2009M PBS, the pellets were fixed with 1% osmic acid at room temperature for 1\u2009h, washed three times with double-distilled H2O, dehydrated in a graded ethanol series, slowly infiltrated with 100% acetone and 50% acetone (acrylic resin: acetone,1:1, v\/v) for 2\u2009h and embedded in acrylic resin at 60\u2009\u00b0C for 48\u2009h. The embedded samples were cut into sections with a thickness of 70\u2009nm, and the sections were stained with 2% uranyl acetate at room temperature for 10\u201320\u2009min and lead citrate stain the sections for 5\u2009min. Lastly, samples were observed by electron microscope and images were captured by FEI Tecnai G2 spirit electron microscope.<\/p>\n HeLa cells were lysed using lysis buffer and centrifuged at 12,000\u2009rpm for 10\u2009min at 4\u2009\u00b0C. PBS, AcCoA (500\u2009\u00b5M) or CoASH (500\u2009\u00b5M) were added to cell lysates, heated to graded temperatures (44.6\u201365\u2009\u00b0C, 3\u2009min) and centrifuged at 12,000\u2009rpm for 10\u2009min at 4\u2009\u00b0C. Soluble proteins were extracted and analysed by immunoblotting.<\/p>\n All data were analysed using GraphPad Prism (v.8.3.0) or Excel, with n\u2009\u2265\u20093 biological replicates unless otherwise specified. Data are presented as mean\u2009\u00b1\u2009s.e.m. or mean\u2009\u00b1\u2009s.d. as indicated. For the CRISPR screen data in Fig. 1e and Extended Data Fig. 5k, n\u2009=\u20092 biological replicates. All statistical tests were two-tailed. Statistical parameters, including scale bars and statistical significance, are shown in the figures and the figure legends. Two-group comparisons were analysed using unpaired t-tests. Multiple comparisons among more than two groups were performed using one-way ANOVA. A two-way ANOVA was used when two categorical variables were analysed. Post hoc analysis was conducted to identify specific group differences following ANOVA. P\u2009<\u20090.05 was considered to be statistically significant.<\/p>\n Further information on research design is available in the\u00a0Nature Portfolio Reporting Summary linked to this article.<\/p>\n","protected":false},"excerpt":{"rendered":" Mouse studies Wild-type C57BL\/6 male mice (6\u20138\u2009weeks\u00a0of age) were purchased from BIKAI. Nlrx1\u2212\/\u2212 mice were purchased from Cyagen. NSG mice were purchased from Shanghai Model Organisms Center. All mice were housed in the specific-pathogen-free animal facility of Fudan University with the following environmental parameters: temperature maintained at 21\u201325\u2009\u00b0C, relative humidity at 45\u201365% and a 12\u2009h\u201312\u2009h<\/p>\n","protected":false},"author":1,"featured_media":0,"comment_status":"open","ping_status":"open","sticky":false,"template":"","format":"standard","meta":{"footnotes":""},"categories":[58],"tags":[],"class_list":{"0":"post-33103","1":"post","2":"type-post","3":"status-publish","4":"format-standard","6":"category-science"},"_links":{"self":[{"href":"https:\/\/naijaglobalnews.org\/index.php?rest_route=\/wp\/v2\/posts\/33103","targetHints":{"allow":["GET"]}}],"collection":[{"href":"https:\/\/naijaglobalnews.org\/index.php?rest_route=\/wp\/v2\/posts"}],"about":[{"href":"https:\/\/naijaglobalnews.org\/index.php?rest_route=\/wp\/v2\/types\/post"}],"author":[{"embeddable":true,"href":"https:\/\/naijaglobalnews.org\/index.php?rest_route=\/wp\/v2\/users\/1"}],"replies":[{"embeddable":true,"href":"https:\/\/naijaglobalnews.org\/index.php?rest_route=%2Fwp%2Fv2%2Fcomments&post=33103"}],"version-history":[{"count":0,"href":"https:\/\/naijaglobalnews.org\/index.php?rest_route=\/wp\/v2\/posts\/33103\/revisions"}],"wp:attachment":[{"href":"https:\/\/naijaglobalnews.org\/index.php?rest_route=%2Fwp%2Fv2%2Fmedia&parent=33103"}],"wp:term":[{"taxonomy":"category","embeddable":true,"href":"https:\/\/naijaglobalnews.org\/index.php?rest_route=%2Fwp%2Fv2%2Fcategories&post=33103"},{"taxonomy":"post_tag","embeddable":true,"href":"https:\/\/naijaglobalnews.org\/index.php?rest_route=%2Fwp%2Fv2%2Ftags&post=33103"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}[3H]AcCoA binding assay<\/h3>\n
Protein oligomerization analysis<\/h3>\n
Molecular modelling for AcCoA binding to NLRX1<\/h3>\n
Flow cytometry<\/h3>\n
ATP measurement and cell death assay<\/h3>\n
Measurement of NADP(H)<\/h3>\n
2D cell proliferation<\/h3>\n
Metabolite extraction and GC\u2013MS<\/h3>\n
Metabolite extraction and LC\u2013MS<\/h3>\n
Seahorse analysis<\/h3>\n
CRISPR screening<\/h3>\n
qPCR analysis<\/h3>\n
Immunofluorescence and confocal microscopy<\/h3>\n
Mitophagy reporter assay<\/h3>\n
Cytochrome c release analysis<\/h3>\n
Tissue mitochondrial isolation<\/h3>\n
Electron microscopy<\/h3>\n
Thermal shift assay<\/h3>\n
Statistical analysis<\/h3>\n
Reporting summary<\/h3>\n